Protocols
Published step-by-step workflows for FAS2rDNA in research settings.
FAS2rDNA-Colab: A cloud-based workflow for pan-cancer, isoform-wide miRNome reconstitution across TCGA cohorts
Describes use of FAS2rDNA-Colab to reconstruct isoform-wide miRNA sequences from TCGA cohorts using publicly available annotation datasets. Covers input preparation, assembly selection, execution, and output interpretation.
DOI: 10.17504/protocols.io.14egn1xr6v5d/v1High-throughput isoform-wide miRNome sequence reconstruction in the TCGA-LUAD cohort using FAS2rDNA
Demonstrates a high-throughput workflow for reconstructing miRNome sequences from the TCGA Lung Adenocarcinoma (LUAD) cohort. Covers data sourcing from miRBase and TCGA, coordinate formatting, batch execution, and downstream integration.
DOI: 10.17504/protocols.io.rm7vzenqxvx1/v1Input format specification
All FAS2rDNA implementations share the same tab-delimited input format (.txt or .tsv) with these mandatory columns:
| Column | Required | Description | Example |
|---|---|---|---|
sample_id | Yes | Sample identifier used as FASTA header | BLOOD_001 |
seq_loc | Yes | Genomic coordinate in FAS2rDNA format | hg19:9:106938220-106938244:+ |
seq_id | Yes | Sequence identifier (e.g. gene name) | hsa-miR-31-5p |
description | Yes | Annotation or description of the entry | mature miRNA, plus strand |
Note: The use of gene_id instead of seq_id is still supported.
seq_loc format
assembly:chromosome:start-end:strand Examples: hg19:9:106938220-106938244:+ hg38:chr7:55019369-55019369:- mm10:4:100000000-100001000:+
Expected input
sample_id seq_id seq_loc description BLOOD_001 hsa-miR-31-5p hg19:9:106938220-106938244:+ precursor miRNA LIVER_A2 hsa-miR-21-5p hg19:17:57918627-57918648:+ mature miRNA
Expected output
>BLOOD_001 | hsa-miR-31-5p | mature miRNA, plus strand | hg19:9:106938220-106938244:+ AGGCAAGAUGCUGGCAUAGCU >LIVER_A2 | hsa-miR-21-5p | oncomiR | hg19:17:57918627-57918648:+ UAGCUUAUCAGACUGAUGUUGA
Supported assemblies
Human
hg16 hg17 hg18 hg19 hg38 hs1
Mouse
mm7 mm8 mm9 mm10 mm39
Rat
rn4 rn5 rn6 rn7
Zebrafish
danRer7 danRer10 danRer11
Fruit Fly
dm2 dm3 dm6
C. elegans
ce4 ce6 ce10 ce11
Yeast
sacCer1 sacCer2 sacCer3
For unsupported assemblies, please contact us. Reference genome information: UCSC Genome Browser.
Sample run
Attention: Include the madatory columns: sample_id, seq_id, seq_loc, and description. Other columns are optional.
input data (tab-separated)
sample_id seq_id seq_loc read_count description cross-mapped miRNA_region Unknown-1 hsa-let-7a-1 hg19:9:96938220-96938244:+ 2 1.988671 N precursor Unknown-1 hsa-let-7a-1 hg19:9:96938242-96938265:+ 1 0.994335 N "mature,MIMAT0000062" Unknown-1 hsa-let-7a-1 hg19:9:96938243-96938265:+ 2 1.988671 N "mature,MIMAT0000062" Unknown-1 hsa-let-7a-1 hg19:9:96938243-96938266:+ 3 2.983006 N "mature,MIMAT0000062" Unknown-1 hsa-let-7a-1 hg19:9:96938244-96938263:+ 18 17.898035 N "mature,MIMAT0000062" Unknown-1 hsa-let-7a-1 hg19:9:96938244-96938264:+ 276 274.436535 N "mature,MIMAT0000062" Unknown-1 hsa-let-7a-1 hg19:9:96938244-96938265:+ 800 795.468218 N "mature,MIMAT0000062" Unknown-1 hsa-let-7a-1 hg19:9:96938244-96938266:+ 4703 4676.358784 N "mature,MIMAT0000062" Unknown-1 hsa-let-7a-1 hg19:9:96938244-96938267:+ 164 163.070985 N "mature,MIMAT0000062" Unknown-1 hsa-let-7a-1 hg19:9:96938244-96938268:+ 6 5.966012 N "mature,MIMAT0000062" Unknown-1 hsa-let-7a-1 hg19:9:96938245-96938265:+ 1 0.994335 N "mature,MIMAT0000062" Unknown-1 hsa-let-7a-1 hg19:9:96938245-96938266:+ 8 7.954682 N "mature,MIMAT0000062" Unknown-1 hsa-let-7a-1 hg19:9:96938247-96938265:+ 1 0.994335 N "mature,MIMAT0000062" Unknown-1 hsa-let-7a-1 hg19:9:96938247-96938266:+ 12 11.932023 N "mature,MIMAT0000062" Unknown-1 hsa-let-7a-1 hg19:9:96938248-96938266:+ 5 4.971676 N "mature,MIMAT0000062" Unknown-1 hsa-let-7a-1 hg19:9:96938249-96938266:+ 1 0.994335 N "mature,MIMAT0000062" Unknown-1 hsa-let-7a-1 hg19:9:96938251-96938267:+ 2 1.988671 N "mature,MIMAT0000062" Unknown-1 hsa-let-7a-1 hg19:9:96938266-96938289:+ 1 0.994335 N stemloop Unknown-1 hsa-let-7a-1 hg19:9:96938295-96938313:+ 1 0.994335 N "star,MIMAT0004481" Unknown-1 hsa-let-7a-1 hg19:9:96938295-96938315:+ 1 0.994335 N "star,MIMAT0004481" Unknown-1 hsa-let-7a-1 hg19:9:96938295-96938316:+ 10 9.943353 N "star,MIMAT0004481"
output data (multi-FASTA)
>Unknown-1 | hsa-let-7a-1 | 1.988671 | hg19:9:96938220-96938244:+ CTGGATGTTCTCTTCACTGTGGGAT >Unknown-1 | hsa-let-7a-1 | 0.994335 | hg19:9:96938242-96938265:+ GATGAGGTAGTAGGTTGTATAGTT >Unknown-1 | hsa-let-7a-1 | 1.988671 | hg19:9:96938243-96938265:+ ATGAGGTAGTAGGTTGTATAGTT >Unknown-1 | hsa-let-7a-1 | 2.983006 | hg19:9:96938243-96938266:+ ATGAGGTAGTAGGTTGTATAGTTT >Unknown-1 | hsa-let-7a-1 | 17.898035 | hg19:9:96938244-96938263:+ TGAGGTAGTAGGTTGTATAG >Unknown-1 | hsa-let-7a-1 | 274.436535 | hg19:9:96938244-96938264:+ TGAGGTAGTAGGTTGTATAGT >Unknown-1 | hsa-let-7a-1 | 795.468218 | hg19:9:96938244-96938265:+ TGAGGTAGTAGGTTGTATAGTT >Unknown-1 | hsa-let-7a-1 | 4676.358784 | hg19:9:96938244-96938266:+ TGAGGTAGTAGGTTGTATAGTTT >Unknown-1 | hsa-let-7a-1 | 163.070985 | hg19:9:96938244-96938267:+ TGAGGTAGTAGGTTGTATAGTTTT >Unknown-1 | hsa-let-7a-1 | 5.966012 | hg19:9:96938244-96938268:+ TGAGGTAGTAGGTTGTATAGTTTTA >Unknown-1 | hsa-let-7a-1 | 0.994335 | hg19:9:96938245-96938265:+ GAGGTAGTAGGTTGTATAGTT >Unknown-1 | hsa-let-7a-1 | 7.954682 | hg19:9:96938245-96938266:+ GAGGTAGTAGGTTGTATAGTTT >Unknown-1 | hsa-let-7a-1 | 0.994335 | hg19:9:96938247-96938265:+ GGTAGTAGGTTGTATAGTT >Unknown-1 | hsa-let-7a-1 | 11.932023 | hg19:9:96938247-96938266:+ GGTAGTAGGTTGTATAGTTT >Unknown-1 | hsa-let-7a-1 | 4.971676 | hg19:9:96938248-96938266:+ GTAGTAGGTTGTATAGTTT >Unknown-1 | hsa-let-7a-1 | 0.994335 | hg19:9:96938249-96938266:+ TAGTAGGTTGTATAGTTT >Unknown-1 | hsa-let-7a-1 | 1.988671 | hg19:9:96938251-96938267:+ GTAGGTTGTATAGTTTT >Unknown-1 | hsa-let-7a-1 | 0.994335 | hg19:9:96938266-96938289:+ TTAGGGTCACACCCACCACTGGGA >Unknown-1 | hsa-let-7a-1 | 0.994335 | hg19:9:96938295-96938313:+ CTATACAATCTACTGTCTT >Unknown-1 | hsa-let-7a-1 | 0.994335 | hg19:9:96938295-96938315:+ CTATACAATCTACTGTCTTTC >Unknown-1 | hsa-let-7a-1 | 9.943353 | hg19:9:96938295-96938316:+ CTATACAATCTACTGTCTTTCC
View sample data
See examples →
See sample input and output data for all supported assemblies.